Improve FastQC error description in case of multi-line FASTQ file input

Scenario:

1. In UGENE main menu select "Tools > NGS data analysis > Reads quality control".
2. Select the attached file "multiline_fastq.fastq" as input.
3. Run the workflow.
   Current result:

• There is red status on the result dashboard: "The workflow task has been finished with errors!".
• There is no error notifications on the dashboard.
• There is the following message in the UGENE log:

  Tool FastQC finished successfully
  

• On the "External Tools" tab of the dashboard there is an error:

  Failed to process /...(some path)/multiline_fastq.fastq
  uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'TCAAGGATGGGGTAGTTCACTGGAAGGGGGTGAAGGTTGGTCAGATGGTAGATGGCCGACTGTCCGCAGATGAACAATTCAAGAACCAGGAGGACTTGCTA' didn't start with '+'
  ...
  

  Expected result:

• There is red status on the result dashboard: "The workflow task has been finished with errors!".
• There is the following error notification on the dashboard:

  FastQC failed to process input file '%1'. Make sure each read takes exactly four lines.
  

• There is the following message in the UGENE log:

  [ERROR] Tool FastQC finished with an error.
  [DETAILS] FastQC failed to process input file '%1'. Make sure each read takes exactly four lines.
  

• There is FastQC error in the UGENE log in "TRACE" (the same as on the "External Tools" tab).

Note that the issue occurs because the input FASTQ file contains sequences and their quality values specified in multi-line format.
Output this message:

FastQC failed to process input file '%1'. Make sure each read takes exactly four lines.

only when both errors "uk.ac.babraham.FastQC.Sequence.SequenceFormatException" and "didn't start with '+'" are present. Otherwise, output:

FastQC failed to process input file '%1'.

Make sure info about FastQC exceptions in written to the UGENE log in any case.

Also, note that during DEV-32-3 sprint review another behavior was detected: there was an error notification on the dashboard, but it was not clear enough:

Result file does not exist: /var/folders/kb/....(some strange path and the file name).html. See the log for details.