The reverse sequences in Task report [PCR Primer Design For DNA Assembly Task] should be taken from complementary sequence

1. Open _common_data/pcr_primer_design/backbone.fa
2. Open PCR Primer Design for DNA Assembly Tab.
3. Set Parameters of priming sequences -> Melting point -> 48.
4. Start. Wait for task to finish.
5. Open report.
   Expected: A Reverse sequence is "AAGGGTATCACCTTCAAACTT" (same as annotation table).
   Current: A Reverse is "AAGTTTGAAGGTGATACCCTT" (same area as annotation, but derived from forward rather than complementary)

Likewise for all other reverse sequences.