Crash in case of the exporting of PCR result with an empty annotation table

Scenario:

1. Open human_T1.fa.
2. Click "Ctrl+A", set 80-90 as region, click "Go".
3. Click "Ctrl+N", in the appeared dialog click "OK" with the default settings.
   Expected: the annotation has appeared.
4. Select the "Misc. Feature" annotation and click "Delete".
   Expected: the annotation has been removed, BUT the annotation table (with the same name "Misc. Feature") is still here.
5. Open the "In silico PCR" tab.
6. Set "TTGTCAGATTCACCAAAGTT" as a forward primer and "CTCTCTTCTGGCCTGTAGGGTTTCTG" as a reverse primer.
7. Click "Find product(s) anyway".
   Expected: the only product has been found.
8. Select the only result in the result table and click "Extract primer".
   Expected: the primer has been extracted with the empty annotation table.
   Current: UGENE has crashed.

This crash has been found thanks to the crash report №24472.