-
Type: Bug
-
Status: Closed
-
Priority: Major
-
Resolution: Fixed
-
Affects Version/s: 1.10.4
-
Fix Version/s: 1.11
-
Component/s: None
-
Labels:None
Currently FASTQ format is not properly supported. UGENE can't open even sample sequences from Wikipedia:
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
Moreover, the Workflow Designer doesn't detect that it doesn't support a FASTQ file and hangs on the sequence converting task (another issue should be created?).