Invalid extracted PCR product when a primer goes through the circular sequence start coordinate

See issue 2 from here: http://ugene.net/forum/YaBB.pl?num=1573198816/3#3.

Scenario:

1. Open the attached sequence "pET-24.gb".
   Expected result: the sequence is circular (icon for the sequence object in the Project View is circular). The Sequence View with the Circular Vies is shown.
2. Open the "In Silico PCR" tab on the options panel.
3. Set:
   • "Forwad primer" to "GCTCTCCCTTATGCGACTCC".
   • "Reverse primer" to "GCGTCCCATTCGCCAATCC".
4. Click the "Find product anyway" button.
   Expected result: length of the extracted region is 642 bp.
5. Click the "Extract product(s)" button.
   Expected result  the extracted sequence is 642 bp long.
   Actual result:  the extracted sequence is 39 bp long, it is made of primers joined together.