-
Type: Task
-
Status: Closed
-
Priority: Major
-
Resolution: Fixed
-
Affects Version/s: 33
-
Fix Version/s: 34
-
Component/s: Basic-Nucl
-
Labels:
-
Story Points:3
-
Sprint:DEV-34-6, DEV-34-7, DEV-34-8
-
Affect Type:Userdefined
Scenario:
- Open the attached sequence "pET-24.gb".
Expected result: the sequence is circular (icon for the sequence object in the Project View is circular). The Sequence View with the Circular Vies is shown. - Open the "In Silico PCR" tab on the options panel.
- Set:
- "Forward primer" to "GCTCTCCCTTATGCGACTCC", "Mismatches" to "15".
- "Reverse primer" to "GCGTCCCATTCGCCAATCC", "Mismatches" to "50".
- Click the "Find product anyway" button.
Actual result: a SAFE_POINT is triggered.Trying to recover from error: Internal error! Wrong match length at src\InSilico PcrTask.cpp:218 Assertion failed: sequenceLength == primerLength, file src\InSilicoPcrTask.cpp, line 218
- relates to
-
UGENE-6649 Invalid extracted PCR product when a primer goes through the circular sequence start coordinate
- Closed