SAFE_POINT on finding PCR product when the number of mismatches is larger than the primer length

Scenario:

1. Open the attached sequence "pET-24.gb".
   Expected result: the sequence is circular (icon for the sequence object in the Project View is circular). The Sequence View with the Circular Vies is shown.
2. Open the "In Silico PCR" tab on the options panel.
3. Set:
   • "Forward primer" to "GCTCTCCCTTATGCGACTCC", "Mismatches" to "15".
   • "Reverse primer" to "GCGTCCCATTCGCCAATCC", "Mismatches" to "50".
4. Click the "Find product anyway" button.
   Actual result:  a SAFE_POINT is triggered.

   Trying to recover from error: Internal error! Wrong match length at src\InSilico PcrTask.cpp:218
    Assertion failed: sequenceLength == primerLength, file src\InSilicoPcrTask.cpp, line 218